Top » Catalog » SNPs » S953

$18.00

S953
[S953]

S953
hg38 Position: ChrY:11933546..11933546
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z3004
Forward Primer: S953_F GAGACTGTGACAGATCATCAAGC
Reverse Primer: S953_R GGGTAAACTTATCTATCCATCCTCTATC
Reviews

Customers who bought this product also purchased
FGC3213
FGC3213
Z16274
Z16274
DF13
DF13
R1b-DF21 Panel
R1b-DF21 Panel
Z3004
Z3004
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies