Top » Catalog » SNPs » BY24084

$19.00

BY24084
[BY24084]

BY24084
hg38 Position: ChrY:15636994..15636994
Ancestral: C
Derived: T
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: FGC5561 > Z16503 > Z16502 > Z17653 > L1444 > A1273
Forward Primer: BY24084v2_F CGCAGAGTGGTTAAGGGC
Reverse Primer: BY24084v2_R CTAGAACTGTTCTGCCACTCAGC
Reviews

Customers who bought this product also purchased
BY23836
BY23836
Wish a SNP
Wish a SNP
DNA Sample Kit
DNA Sample Kit
M7884
M7884
A1284
A1284
A1283
A1283
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies