Top » Catalog » SNPs » Z16274

$18.00

Z16274
[Z16274]

Z16274
hg38 Position: ChrY:16000059..16000059
Ancestral: C
Derived: G
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: downstream of DF21
Forward Primer: Z16274_F AGTCTCAGCGCTCTGGTAGG
Reverse Primer: Z16274_R AACTCTCAGCATTGGGCAAC
Reviews

Customers who bought this product also purchased
S5488
S5488
A7923
A7923
DF49
DF49
DF5
DF5
A14079
A14079
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies