Top » Catalog » SNPs » Z16274

$18.00

Z16274
[Z16274]

Z16274
hg38 Position: ChrY:16000059..16000059
Ancestral: C
Derived: G
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: downstream of DF21
Forward Primer: Z16274_F AGTCTCAGCGCTCTGGTAGG
Reverse Primer: Z16274_R AACTCTCAGCATTGGGCAAC
Reviews

Customers who bought this product also purchased
FGC3213
FGC3213
S953
S953
DF13
DF13
R1b-DF21 Panel
R1b-DF21 Panel
Z3004
Z3004
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies