Top » Catalog » SNPs » YP590

$18.00

YP590
[YP590]

YP590
hg38 Position: ChrY:16487119..16487119
Ancestral: C
Derived: T
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: Below L260 > YP414
Forward Primer: YP590_F AATCACAGATGGTTGCATTCC
Reverse Primer: YP590_R TGATCCTAGTTAGTTAGGACACTAACTCAC
Reviews

Customers who bought this product also purchased
R1a-M458 Panel
R1a-M458 Panel
Y2905
Y2905
BY137355
BY137355
YP414
YP414
BY142582
BY142582
YP254
YP254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies