Top » Catalog » SNPs » Z16294

$18.00

Z16294
[Z16294]

Z16294
hg38 Position: ChrY:19487522..19487522
Ancestral: G
Derived: A
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1g3b
Comments: downstream of DF21
Forward Primer: Z16294_F CATACTGCCATGGAGACACC
Reverse Primer: Z16294_R CTCTGGTTCCTGCCTCTGAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
R1b-Z2103 Panel
R1b-Z2103 Panel
Z2103
Z2103
Z29644
Z29644
M985
M985
FGC14590
FGC14590
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies