Top » Catalog » SNPs » A20673

$18.00

A20673
[A20673]

A20673
hg38 Position: ChrY:6943808..6943808
Ancestral: A
Derived: G
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20673_F AACCAAGCAACCAACCAAAG
Reverse Primer: A20673_R TGAGCCACTGGTGTTTTGAG
Reviews

Customers who bought this product also purchased
A19343
A19343
A19932
A19932
A19348
A19348
M12430
M12430
A19353
A19353
A19342
A19342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies