Top » Catalog » SNPs » A20673

$18.00

A20673
[A20673]

A20673
hg38 Position: ChrY:6943808..6943808
Ancestral: A
Derived: G
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20673_F AACCAAGCAACCAACCAAAG
Reverse Primer: A20673_R TGAGCCACTGGTGTTTTGAG
Reviews

Customers who bought this product also purchased
A19341
A19341
A19357
A19357
A19346
A19346
CTS10301
CTS10301
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies