Top » Catalog » SNPs » Z3004

$18.00

Z3004
[Z3004]

Z3004
hg38 Position: ChrY:13096660..13096660
Ancestral: C
Derived: T
Reference: David Reynolds (2012)
ISOGG Haplogroup: R1b1a2a1a2c1g5 (not listed)
Comments: Approx. hg R-DF21 > S954
Forward Primer: Z3004_F TTCAACTTTGCCATTCATGC
Reverse Primer: Z3004_R CTATCTCCTGGGCTAGTGTGG
Reviews

Customers who bought this product also purchased
S953
S953
Z16274
Z16274
FGC41929
FGC41929
Z39589
Z39589
FGC41930
FGC41930
A7923
A7923
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies