Top » Catalog » SNPs » Z3004

$18.00

Z3004
[Z3004]

Z3004
hg38 Position: ChrY:13096660..13096660
Ancestral: C
Derived: T
Reference: David Reynolds (2012)
ISOGG Haplogroup: R1b1a2a1a2c1g5 (not listed)
Comments: Approx. hg R-DF21 > S954
Forward Primer: Z3004_F TTCAACTTTGCCATTCATGC
Reverse Primer: Z3004_R CTATCTCCTGGGCTAGTGTGG
Reviews

Customers who bought this product also purchased
DF27
DF27
Z2106
Z2106
Z16292
Z16292
P312
P312
U152
U152
R1b-Z2103 Panel
R1b-Z2103 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies