Top » Catalog » SNPs » Z3004

$18.00

Z3004
[Z3004]

Z3004
hg38 Position: ChrY:13096660..13096660
Ancestral: C
Derived: T
Reference: David Reynolds (2012)
ISOGG Haplogroup: R1b1a2a1a2c1g5 (not listed)
Comments: Approx. hg R-DF21 > S954
Forward Primer: Z3004_F TTCAACTTTGCCATTCATGC
Reverse Primer: Z3004_R CTATCTCCTGGGCTAGTGTGG
Reviews

Customers who bought this product also purchased
L21
L21
FGC14589
FGC14589
FGC33047
FGC33047
DF19
DF19
Y113338
Y113338
CTS9219
CTS9219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies