Top » Catalog » SNPs » Z3004

$18.00

Z3004
[Z3004]

Z3004
hg38 Position: ChrY:13096660..13096660
Ancestral: C
Derived: T
Reference: David Reynolds (2012)
ISOGG Haplogroup: R1b1a2a1a2c1g5 (not listed)
Comments: Approx. hg R-DF21 > S954
Forward Primer: Z3004_F TTCAACTTTGCCATTCATGC
Reverse Primer: Z3004_R CTATCTCCTGGGCTAGTGTGG
Reviews

Customers who bought this product also purchased
FGC14590
FGC14590
BY12129
BY12129
Z245
Z245
L21
L21
FGC14589
FGC14589
FGC33047
FGC33047
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies