Top » Catalog » SNPs » BY16791

$18.00

BY16791
[BY16791]

BY16791
hg38 Position: ChrY:8204296..8204296
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1695
Forward Primer: BY16791_F AGAAGTTGGTGACCTTGAATGTG
Reverse Primer: BY16791_R AATAACTTAAACAAATTTACAAGAATAAAATAACG
Reviews

Customers who bought this product also purchased
FGC1723
FGC1723
FGC3718
FGC3718
FGC12
FGC12
YSC0000076
YSC0000076
M96
M96
MF113321
MF113321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies