Top » Catalog » SNPs » BY16791

$18.00

BY16791
[BY16791]

BY16791
hg38 Position: ChrY:8204296..8204296
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1695
Forward Primer: BY16791_F AGAAGTTGGTGACCTTGAATGTG
Reverse Primer: BY16791_R AATAACTTAAACAAATTTACAAGAATAAAATAACG
Reviews

Customers who bought this product also purchased
ZS9918
ZS9918
ZS4733
ZS4733
ZS9915
ZS9915
Y138029
Y138029
ZS4726
ZS4726
FT236712
FT236712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies