Top » Catalog » SNPs » FGC22049

$18.00

FGC22049
[FGC22049]

FGC22049
hg38 Position: ChrY:8558414..8558414
Ancestral: G
Derived: A
Reference: Zeljko Kasalica (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Below P109
Forward Primer: FGC22049_F CCACTCTGATTTTTATGTACAACCC
Reverse Primer: FGC22049_R CATATGGATGCCAGCATGTC
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
FGC6198
FGC6198
S310
S310
L48
L48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies