Top » Catalog » SNPs » MZ101

$18.00

MZ101
[MZ101]

MZ101
hg38 Position: ChrY:7901895..7901895
Ancestral: C
Derived: T
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1 (not listed)
Comments: Downstream of MZ97..MZ100
Forward Primer: MZ101_F CCTTCTCGGCTTCCAAAAG
Reverse Primer: MZ101_R GACTCTGCTCAATGTGCTTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies