Top » Catalog » SNPs » Z5011

$18.00

Z5011
[Z5011]

Z5011
hg38 Position: ChrY:12805177..12805177
Ancestral: G
Derived: A
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5011_F TTGCTGCTTTCAAGATTCTCC
Reverse Primer: Z5011_R TAAGATGGTCCCGACAAAGG
Reviews

Customers who bought this product also purchased
MZ270
MZ270
Z834
Z834
BY9698
BY9698
A2227
A2227
MZ99
MZ99
FT201404
FT201404
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies