Top » Catalog » SNPs » Z5011

$18.00

Z5011
[Z5011]

Z5011
hg38 Position: ChrY:12805177..12805177
Ancestral: G
Derived: A
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5011_F TTGCTGCTTTCAAGATTCTCC
Reverse Primer: Z5011_R TAAGATGGTCCCGACAAAGG
Reviews

Customers who bought this product also purchased
FT395671
FT395671
MZ232
MZ232
Y110637
Y110637
V12
V12
V6588
V6588
MZ177
MZ177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies