Top » Catalog » SNPs » BY33091

$18.00

BY33091
[BY33091]

BY33091
hg38 Position: ChrY:16814288..16814288
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: N
Comments: Downstream BY21977
Forward Primer: BY33091_F CCAGGTCTCTCCCATGACAC
Reverse Primer: BY33091_R TGTGGCACAAATAAGCTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies