Top » Catalog » SNPs » Y66837

$18.00

Y66837
[Y66837]

Y66837
hg38 Position: ChrY:12404995..12404995
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y66837_F GCCTCCAAATGACTTCTTTCC
Reverse Primer: Y66837_R CAGGCATTTGATTAACGCATC
Reviews

Customers who bought this product also purchased
YFS1655160
YFS1655160
Y76017
Y76017
ZS6172
ZS6172
Y60679
Y60679
Y69004
Y69004
ZS10716
ZS10716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS660
1 x A4560
1 x A1967
$54.00
Haplogroup Info
Other products
Currencies