Top » Catalog » SNPs » Y66837

$18.00

Y66837
[Y66837]

Y66837
hg38 Position: ChrY:12404995..12404995
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y66837_F GCCTCCAAATGACTTCTTTCC
Reverse Primer: Y66837_R CAGGCATTTGATTAACGCATC
Reviews

Customers who bought this product also purchased
Y68659
Y68659
ZS10715
ZS10715
Y61962
Y61962
ZS10720
ZS10720
ZS10712
ZS10712
ZS10714
ZS10714
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies