Top » Catalog » SNPs » Y68659

$18.00

Y68659
[Y68659]

Y68659
hg38 Position: ChrY:13576479..13576479
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: Below FGC1695 > ZS10710
Forward Primer: Y68659v2_F AATAGGAATGCTTTTACACTGTTGC
Reverse Primer: Y68659v2_R TGTGTCCATGTATTCTCATTGTTTG
Reviews

Customers who bought this product also purchased
ZS10711
ZS10711
ZS10714
ZS10714
Y60807
Y60807
ZS10719
ZS10719
Y66837
Y66837
Y70179
Y70179
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies