Top » Catalog » SNPs » Y68659

$18.00

Y68659
[Y68659]

Y68659
hg38 Position: ChrY:13576479..13576479
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: Below FGC1695 > ZS10710
Forward Primer: Y68659v2_F AATAGGAATGCTTTTACACTGTTGC
Reverse Primer: Y68659v2_R TGTGTCCATGTATTCTCATTGTTTG
Reviews

Customers who bought this product also purchased
J1-ZS10710 Panel
J1-ZS10710 Panel
ZS10718
ZS10718
Y66688
Y66688
YFS1655160
YFS1655160
Y76017
Y76017
ZS6172
ZS6172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies