Top » Catalog » SNPs » Y76017

$18.00

Y76017
[Y76017]

Y76017
hg38 Position: ChrY:19066289..19066289
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: Below FGC1695 > ZS10710
Forward Primer: Y76017_F TTTCAGCCCCAGCTATGAAC
Reverse Primer: Y76017_R ACCTGAGTAGCTCGGACCAC
Reviews

Customers who bought this product also purchased
YFS1655160
YFS1655160
J1-ZS10710 Panel
J1-ZS10710 Panel
ZS10718
ZS10718
Y66688
Y66688
Y69004
Y69004
ZS10716
ZS10716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies