Top » Catalog » SNPs » Y78560

$18.00

Y78560
[Y78560]

Y78560
hg38 Position: ChrY:20567875..20567875
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: Below FGC1695 > ZS10710
Forward Primer: Y78560_F TTCAATGAGGCCACAATTACC
Reverse Primer: Y78560_R TGGATTTATCATGCAGGTTTC
Reviews

Customers who bought this product also purchased
ZS10715
ZS10715
ZS10720
ZS10720
ZS10710
ZS10710
ZS10712
ZS10712
ZS10714
ZS10714
ZS10719
ZS10719
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies