Top » Catalog » SNPs » ZS10712

$19.00

ZS10712
[ZS10712]

ZS10712
hg38 Position: ChrY:13478552..13478552
Ancestral: C
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10712_F AATGCTGCTGTCAATGTTGG
Reverse Primer: ZS10712_R TACAGCGGTGAAGAGTTTGC
Reviews

Customers who bought this product also purchased
FGC47819
FGC47819
BY116488
BY116488
PF6128
PF6128
F1977
F1977
FGC8712
FGC8712
BY50453
BY50453
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies