Top » Catalog » SNPs » ZS10712

$18.00

ZS10712
[ZS10712]

ZS10712
hg38 Position: ChrY:13478552..13478552
Ancestral: C
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10712_F AATGCTGCTGTCAATGTTGG
Reverse Primer: ZS10712_R TACAGCGGTGAAGAGTTTGC
Reviews

Customers who bought this product also purchased
FT207523
FT207523
FGC34373
FGC34373
FGC5
FGC5
FGC11
FGC11
BY16791
BY16791
FT207436
FT207436
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies