Top » Catalog » SNPs » ZS10712

$18.00

ZS10712
[ZS10712]

ZS10712
hg38 Position: ChrY:13478552..13478552
Ancestral: C
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10712_F AATGCTGCTGTCAATGTTGG
Reverse Primer: ZS10712_R TACAGCGGTGAAGAGTTTGC
Reviews

Customers who bought this product also purchased
FGC34373
FGC34373
FGC5
FGC5
FT207523
FT207523
J1-M267 Superclade Panel
J1-M267 Superclade Panel
BY4
BY4
ZS4946
ZS4946
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies