Top » Catalog » SNPs » ZS10714

$18.00

ZS10714
[ZS10714]

ZS10714
hg38 Position: ChrY:18975484..18975484
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10714_F TACAGGTGGGTCCAGGAAAG
Reverse Primer: ZS10714_R CTGTTTGCCAGACATCATGC
Reviews

Customers who bought this product also purchased
YFS1655160
YFS1655160
J1-ZS10710 Panel
J1-ZS10710 Panel
ZS10718
ZS10718
Y66688
Y66688
Y69004
Y69004
Y76017
Y76017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies