Top » Catalog » SNPs » ZS10714

$18.00

ZS10714
[ZS10714]

ZS10714
hg38 Position: ChrY:18975484..18975484
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10714_F TACAGGTGGGTCCAGGAAAG
Reverse Primer: ZS10714_R CTGTTTGCCAGACATCATGC
Reviews

Customers who bought this product also purchased
ZS10715
ZS10715
Y61962
Y61962
ZS10720
ZS10720
ZS10711
ZS10711
Y70179
Y70179
Y60807
Y60807
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies