Top » Catalog » SNPs » ZS10715

$18.00

ZS10715
[ZS10715]

ZS10715
hg38 Position: ChrY:19358233..19358233
Ancestral: G
Derived: T
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10715_F CTTTGCCAACTGTTGTGCTG
Reverse Primer: ZS10715_R TGTCCCCTTTTCCATTTGTG
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
S310
S310
L48
L48
FGC5229
FGC5229
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies