Top » Catalog » SNPs » ZS10716

$18.00

ZS10716
[ZS10716]

ZS10716
hg38 Position: ChrY:19513144..19513144
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10716_F ATTTTGGGGTCATTGCCTTC
Reverse Primer: ZS10716_R CTTTCCCCATTTCCCAAGTC
Reviews

Customers who bought this product also purchased
Y66837
Y66837
YFS1655160
YFS1655160
J1-ZS10710 Panel
J1-ZS10710 Panel
ZS10718
ZS10718
Y66688
Y66688
Y69004
Y69004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies