Top » Catalog » SNPs » ZS10716

$18.00

ZS10716
[ZS10716]

ZS10716
hg38 Position: ChrY:19513144..19513144
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10716_F ATTTTGGGGTCATTGCCTTC
Reverse Primer: ZS10716_R CTTTCCCCATTTCCCAAGTC
Reviews

Customers who bought this product also purchased
ZS6172
ZS6172
Y60679
Y60679
Y68659
Y68659
ZS10715
ZS10715
ZS10710
ZS10710
Y78560
Y78560
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies