Top » Catalog » SNPs » ZS10719

$18.00

ZS10719
[ZS10719]

ZS10719
hg38 Position: ChrY:20566428..20566428
Ancestral: A
Derived: T
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10719v2_F CATCAGAAGTTTACAATGACCAATTC
Reverse Primer: ZS10719v2_R GCATTTTATTGATTTGCTAAGCATG
Reviews

Customers who bought this product also purchased
Y60807
Y60807
ZS10718
ZS10718
Y66837
Y66837
YFS1655160
YFS1655160
J1-ZS10710 Panel
J1-ZS10710 Panel
Y76017
Y76017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies