Top » Catalog » SNPs » ZS10720

$18.00

ZS10720
[ZS10720]

ZS10720
hg38 Position: ChrY:20685375..20685375
Ancestral: A
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10720_F CCTCTGGGTGTCATTGTCTG
Reverse Primer: ZS10720_R TATTTGGGGTCAGTGTCCTG
Reviews

Customers who bought this product also purchased
ZS10715
ZS10715
ZS10710
ZS10710
Y78560
Y78560
ZS10712
ZS10712
ZS10714
ZS10714
Y61962
Y61962
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies