Top » Catalog » SNPs » ZS10720

$18.00

ZS10720
[ZS10720]

ZS10720
hg38 Position: ChrY:20685375..20685375
Ancestral: A
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10720_F CCTCTGGGTGTCATTGTCTG
Reverse Primer: ZS10720_R TATTTGGGGTCAGTGTCCTG
Reviews

Customers who bought this product also purchased
Y61962
Y61962
ZS10719
ZS10719
ZS10711
ZS10711
Y70179
Y70179
Y60807
Y60807
ZS10718
ZS10718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies