Top » Catalog » SNPs » ZS10720

$18.00

ZS10720
[ZS10720]

ZS10720
hg38 Position: ChrY:20685375..20685375
Ancestral: A
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC31318
Forward Primer: ZS10720_F CCTCTGGGTGTCATTGTCTG
Reverse Primer: ZS10720_R TATTTGGGGTCAGTGTCCTG
Reviews

Customers who bought this product also purchased
YFS1655160
YFS1655160
Y76017
Y76017
J1-ZS10710 Panel
J1-ZS10710 Panel
Y66688
Y66688
Y69004
Y69004
ZS10716
ZS10716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies