Top » Catalog » SNPs » Y133674

$18.00

Y133674
[Y133674]

Y133674
hg38 Position: ChrY:12365682..12365682
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y133674_F AATCCCCACACCCTCACAG
Reverse Primer: Y133674_R GAAAGGCACAGGAATAGACTGTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies