Top » Catalog » SNPs » Y133674

$18.00

Y133674
[Y133674]

Y133674
hg38 Position: ChrY:12365682..12365682
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y133674_F AATCCCCACACCCTCACAG
Reverse Primer: Y133674_R GAAAGGCACAGGAATAGACTGTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Prepaid Return Envelope
Prepaid Return Envelope
FGC63912
FGC63912
FGC63911
FGC63911
FGC63906
FGC63906
FGC63898
FGC63898
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies