Top » Catalog » SNPs » A20040

$18.00

A20040
[A20040]

A20040
hg38 Position: ChrY:19947476..19947476
Ancestral: G
Derived: A
Reference: Armando Framarini (2018)
ISOGG Haplogroup: I1
Comments: Downstream S12289
Forward Primer: A20040_F TGAGCCGAGTGTGACTGTTC
Reverse Primer: A20040_R TCCCTGGATGAAAGGACAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies