Top » Catalog » SNPs » A20041

$18.00

A20041
[A20041]

A20041
hg38 Position: ChrY:20786629..20786629
Ancestral: A
Derived: G
Reference: Armando Framarini (2018)
ISOGG Haplogroup: I1
Comments: Downstream S12289
Forward Primer: A20041_F TTCTATGTGAGTGGGATCATGC
Reverse Primer: A20041_R GGAGAAAACAAAACCCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies