Top » Catalog » SNPs » A20045

$18.00

A20045
[A20045]

A20045
hg38 Position: ChrY:15111735..15111735
Ancestral: T
Derived: C
Reference: Armando Framarini (2018)
ISOGG Haplogroup: I1
Comments: Downstream S12289 > A20032
Forward Primer: A20045_F GTGCAATCACAGCTCACTGC
Reverse Primer: A20045_R GGCCCAGCTGTCTTTTTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies