Top » Catalog » SNPs » A20450

$18.00

A20450
[A20450]

A20450
hg38 Position: ChrY:8606305..8606305
Ancestral: G
Derived: C
Reference: William Hartley (2018)
ISOGG Haplogroup: I1
Comments: Downstream Z2535/S1953+ YSC261 L338+ S12289+ A20033+
Forward Primer: A20450_F CCCAGTGTAAACCGTGGAAG
Reverse Primer: A20450_R GAAATGCTAGGCCTTCGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies