Top » Catalog » SNPs » S12408

$18.00

S12408
[S12408]

S12408
hg38 Position: ChrY:9612460..9612460
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1
Comments: Downstream .L1237
Forward Primer: S12408_F TAAATGCTCCCAACCAGGG
Reverse Primer: S12408_R CTTAGAAGAATTGGCCTTGCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies