Top » Catalog » SNPs » Z38742

$18.00

Z38742
[Z38742]

Z38742
hg38 Position: ChrY:7072699..7072699
Ancestral: G
Derived: A
Reference: Al Aburto (2015)
ISOGG Haplogroup: J2
Comments: Below L25 > Z38752
Forward Primer: Z38742_F ATGGTTCAGTGATAGAGAGAGGAAG
Reverse Primer: Z38742_R GCCCTGCCACTGGACATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies