Top » Catalog » SNPs » FGC16743

$18.00

FGC16743
[FGC16743]

FGC16743
hg38 Position: ChrY:19244622..19244622
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222
Forward Primer: FGC16743_F CAAATTCCACCCCCAGATTC
Reverse Primer: FGC16743_R TGGCCCACATAAACTTTCTACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x J2a-M67 Panel
1 x A8549
$106.00
Haplogroup Info
Other products
Currencies