Top » Catalog » SNPs » BY32729

$18.00

BY32729
[BY32729]

BY32729
hg38 Position: ChrY:8365032..8365032
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY32729_F CTTTTTTTGGTGTACCCAATCTTACTAC
Reverse Primer: BY32729_R GATTTGTATTGTACTGTCAATAATAGTAGATATAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies