Top » Catalog » SNPs » A20834

$18.00

A20834
[A20834]

A20834
hg38 Position: ChrY:17080409..17080409
Ancestral: C
Derived: G
Reference: William Hartley (2018)
ISOGG Haplogroup: I1
Comments: Downstream Z2535/S1953 YSC261 L338 S12289 A20033
Forward Primer: A20834_F GCACAAGCAATGATGAAACAG
Reverse Primer: A20834_R GGGCAATGTGAAAGAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies