Top » Catalog » SNPs » FGC63896

$18.00

FGC63896
[FGC63896]

FGC63896
hg38 Position: ChrY:12460808..12460808
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC63896_F AATCTTGGCTCACTGCAACC
Reverse Primer: FGC63896_R ACAGGAGGGACGAGCTAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies