Top » Catalog » SNPs » FGC72518

$18.00

FGC72518
[FGC72518]

FGC72518
hg38 Position: ChrY:8505703..8505703
Ancestral: C
Derived: A
Reference: Mark Nankivell (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC72518_F TAAGGATAGACAAAGAAAAAATGAAAAAAATAG
Reverse Primer: FGC72518_R TTGTACTCAAACAAATATTGGTGCC
Reviews

Customers who bought this product also purchased
Y133699
Y133699
R1b Nankivell Group SNP Test
R1b Nankivell Group SNP Test
Y133674
Y133674
Y133711
Y133711
Y133685
Y133685
Y133668
Y133668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies